Cattitude - The #1 Cat Podcast About Cats As Pets- Pet Life Radio Original (PetLifeRadio.com)

98

In these cat podcasts, learn everything there is to know about cats on Cattitude with your hosts Michelle Fern & Tom Dock.. In this cat podcast, each week we’ll spotlight a cool cat breed, give up-to-date advice on cat health, and check out new cat products! So curl up on the couch every week for a purrr-fectly enjoyable time on Cattitude... on Pet Life Radio.

Recent Episodes
  • Cattitude - Episode 271 Arthritis & the Aging Cat: What Every Cat Parent Should Know
    May 24, 2025 – 28:43
  • Cattitude - Episode 270 From Hiss to Harmony: Solving Cat Aggression
    May 14, 2025 – 33:03
  • Cattitude - Episode 269 One Kitten, One Soldier, One Extraordinary Journey: Silopi - A True Story of Love and Resilience
    May 5, 2025 – 28:12
  • Cattitude - Episode 268 Meow! Cats in Horror, Sci-Fi, and Fantasy Movies
    Apr 9, 2025 – 26:51
  • Cattitude - Episode 267 Not Just Any Cat Sitter: How to Choose the Purr-fessional One!
    Mar 31, 2025 – 33:22
  • Cattitude - Episode 266 Why Can’t My Brother Be More Like My Cat?
    Mar 21, 2025 – 34:44
  • Cattitude - Episode 265 Disaster-Proof Your Pets: Emergency Prep with Dr. Deborah Mandell
    Mar 9, 2025 – 27:40
  • Cattitude - Episode 264 From Sneezes to Snuggles: The Future of Cat Allergy Relief
    Feb 12, 2025 – 29:41
  • Cattitude - Episode 263 Life Is A Catbaret!
    Jan 30, 2025 – 25:27
  • Cattitude - Episode 262 Pawsitive Changes: Resolutions for a Happier, Healthier Cat
    Jan 17, 2025 – 28:28
  • Cattitude - Episode 261 Paws and Reflect: Why 54% of Cat Owners Are Losing Sleep Over Litter Box Woes!
    Jan 2, 2025 – 25:44
  • Cattitude - Episode 260 Cat Behavior Unlocked: Virtual Visits & Feline Fixes with Dr. Maggie O'Brian
    Dec 17, 2024 – 24:55
  • Cattitude - Episode 259 Purr-fect Presents: Holiday Gift Ideas for Your Feline Friends
    Dec 5, 2024 – 25:49
  • Cattitude - Episode 258 Tinsel, Treats, and Trouble: Keeping Cats Safe for the Holidays
    Nov 24, 2024 – 31:05
  • Cattitude - Episode 257 Feline Food For Thought: The Raw Food Debate Explained
    Nov 18, 2024 – 32:17
  • Cattitude - Episode 256 American Cats – The Good, The Bad, The Cuddly
    Nov 4, 2024 – 28:36
  • Cattitude - Episode 255 Two Kittens Are Better Than One!
    Oct 25, 2024 – 32:07
  • Cattitude - Episode 254 Happy Meowloween!
    Oct 17, 2024 – 23:43
  • Cattitude - Episode 253 Boo-tiful Black Cats and Their Halloween Hissss-tory
    Oct 10, 2024 – 21:39
  • Cattitude - Episode 252 Cool Cat Collective Cat Themed Gallery – Buy Cool Stuff, Help Cool Cats!
    Oct 3, 2024 – 25:31
  • Cattitude - Episode 251 Cat Quest III – How to Be a Pirate
    Sep 19, 2024 – 26:21
  • Cattitude - Episode 250 AI-Generated Purrsonality Pics Help Shelter Cats Get Adopted!
    Sep 18, 2024 – 28:15
  • Cattitude - Episode 249 Ten Cats & One Crazy Cat Lady
    Sep 11, 2024 – 30:36
  • Cattitude - Episode 248 A Cat for President?! Morris is Running – & Needs a Running Mate!
    Aug 30, 2024 – 19:49
  • Cattitude - Episode 247 Kitties with Cancer- How Breast Cancer Survivor, Jessica Baladad, Handles Her Cat's Cancer Diagnosis
    Aug 22, 2024 – 29:44
  • Cattitude - Episode 246 Mission Meow
    Aug 14, 2024 – 26:40
  • Cattitude - Episode 245 A Cat House Takeover: Cat Parenthood is Rising!
    Aug 4, 2024 – 27:28
  • Cattitude - Episode 244 Alycat and the Sunday Scaries
    Jul 26, 2024 – 20:42
  • Cattitude - Episode 243 BestyBnB - Safe, Temporary Homes For Pets During Their Owners’ Time Of Crisis
    Jul 16, 2024 – 23:38
  • Cattitude - Episode 242 The Heat is On! Tips to Keep your Cats Cool in the Sizzling Summer!
    Jul 3, 2024 – 27:47
  • Cattitude - Episode 241 Give Them Ten!
    Jun 25, 2024 – 32:36
  • Cattitude - Episode 240 Pets and the City
    Jun 21, 2024 – 36:55
  • Cattitude - Episode 239 Plasma Please!
    Jun 13, 2024 – 28:15
  • Cattitude - Episode 238 Yes, Nonprofits Can Be Fun! Guests Play, Relax and Purr at Cute and Quirky Tail Town Cat Café Lounge Filled with Adoption-Ready Rescue Kitties
    May 31, 2024 – 30:03
  • Cattitude - Episode 237 DNA is Love – Jewelry and Keepsakes Created with your Cat’s DNA!
    May 25, 2024 – 28:23
  • Cattitude - Episode 236 Transitioning Cats to a Holistic Lifestyle
    May 15, 2024 – 23:43
  • Cattitude - Episode 235 Shaken Not Purred: Kitty Themed Cocktails for Cat Lovers
    Apr 30, 2024 – 26:22
  • Cattitude - Episode 234 My One-Eyed, Three-Legged Therapist
    Apr 12, 2024 – 33:25
  • Cattitude - Episode 233 Meet ‘Mayo Cat’, the Adorable Cat Who Starred in Hellmann’s Super Bowl Ad!
    Mar 28, 2024 – 26:47
  • Cattitude - Episode 232 Bringing the Outdoors In: How to Create a Cat Wonderland in the Safety of Your Home
    Mar 15, 2024 – 28:23
  • Cattitude - Episode 231 New Telehealth Law Is Changing the Way Vets And Cat Parents Interact with Their Furry Friends
    Mar 5, 2024 – 27:18
  • Cattitude - Episode 230 The Real Scoop on Hairballs: What Every Cat Parent Should Know
    Feb 27, 2024 – 25:16
  • Cattitude - Episode 229 Brushing Up on Pet Dental Health Month!
    Feb 15, 2024 – 23:23
  • Cattitude - Episode 228 Play With Your Cat!
    Feb 7, 2024 – 39:21
  • Cattitude - Episode 227 Cats Without Coats Part 2 – More About Sphynx Cats!
    Jan 25, 2024 – 32:25
  • Cattitude - Episode 226 Therapetixx – Leading the Industry in Natural & Holistic Pet Care
    Jan 19, 2024 – 36:48
  • Cattitude - Episode 225 Cat Chakras
    Dec 29, 2023 – 35:23
  • Cattitude - Episode 224 Can Your Cat Be a Therapy Cat?
    Dec 8, 2023 – 27:25
  • Cattitude - Episode 223 Meet the Cat Rescuer Who Has Fostered More Than 3000 Cats!
    Nov 28, 2023 – 32:04
  • Cattitude - Episode 222 When You Want Those Nine Lives to be Long Ones!
    Nov 1, 2023 – 30:46
Recent Reviews
  • LilyVivii
    New owner
    I’m a new owner and wow impressed on how informative and quick this podcast is!!!
  • ET crazy cat teen
    My afternoon
    I have finally found other cat friends. I listen to this podcast with my cat. 🤣
  • IdahoIsAwesome
    Meow-mazing 😻
    My 11-year-old daughter loves this show. She’s always sharing cat facts. She especially loves when the host(s) deep dive into specific breeds.
  • mark-griskey
    Review
    As a professional composer, I love your groovy Cat music. Btw my wife and I participated in catch fix and release when we were living in Southern California. We had a huge feral population living in our neighborhood and caught and released about to a dozen cats and fortunately, some local vets would give us discounts for fixing ferals. We adopted 3 feral kittens and it was a real chore to socialize them. The one snuggling me right now “princess” would even let us touch her for over 2 years. I love these animals! Thanks for your show.
  • 1738153
    Nice
    My cat loves to listen to it on his fun day (every second Friday)
  • Griff1210
    Cat
    😻😻😻😻😻😻😻😻😻😻😻😻😻
  • wed could
    I ❤️cats
    🐈 great podcast for 🐈‍⬛
  • Alicia Sweezer
    Great Podcast!
    I really enjoyed the recent episode about playing with your cat. I am glad to see there are more and more resources being created to teach pet parents everything about their cats.
  • Improvement would be ok
    Meh
    Boring Ngl
  • cats rule, dogs drule
    Ilovecats
    I love cats my grandmother has five cats.
  • wyntgl
    Sound is Perfect
    Not sure why some think the sound is too loud. There is something called Volume adjust on your phone. Turn it down:).
  • Kittycat 10
    I LOVE CATs Because THeY RuLe
    And if it’s to loud person then lower down the volume #Stay watermelon 🍉#CATlover🐱
  • dotuser
    Cool 😎 cat 🐈
    I love cats! It’s so great that I have a podcast that actually talks about my favorite animal again I love cats but I think I should I love dogs to raccoons and other things anyways I love ❤️ this podcast it’s so great! Anyways bye 👋 spot the difference ⏩⏩⏩⏩⏩⏩⏩⏩⏩⏩⏩⏩⏩⏩⏪⏩⏩⏩⏩⏩⏩⏩⏩⏩⏩⏩⏩⏩⏩⏩⏩⏩✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻🤚🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻✋🏻🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦝🦡🦝🦝🦝🦝🦝🦝🦝🦝🦝🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌘🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒🌒⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️☃️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️⛄️
  • Jenna81818
    #201
    Episode #201 was published just 2 days after we lost our Fergie girl to kidney disease. Listening to this episode, I couldn’t help but think that this was Fergie’s way of sending a balloon to us that she is at peace, no longer suffering, and knows much much she is loved and missed. Michelle is the best.
  • Squilfrocks
    Hi
    Hey love the podcast also tip for newlGmanager TURN THE VOLUME DOWN. See easy fix
  • ndnvdn
    New breed
    Can you do one about blue Russians?
  • Love😌😆😍🥰🐱🐴🥳💟☪️💤🚺
    I love cats soooooooo much and a podcast about cats perrrrfect
    I love cats soooooooooooooooooooooooo much I’d say I love cats more than anyone in the world I have 3 cats and one bunny and my cats are so happy because I’v listened to this podcast. I’m so happy!!!!!!!!!!!!!!👍🏻👍🏻👍🏻👍🏻👍🏻👍🏻👍🏻👍🏻👍🏻👍🏻👍🏻😻😻😻😻😻😻😻😻😻😻👍🏻😻😻😻👍🏻👍🏻😻😻😻😻😻😻😻👍🏻👍🏻👍🏻👍🏻👍🏻👍🏻👍🏻👍🏻👍🏻☀️☀️☀️☀️☀️☀️☀️☀️☀️☀️☀️☀️☀️☀️👍🏻👍🏻👍🏻👍🏻👍🏻👍🏻👍🏻👍🏻🥰🥰🥰🥰🥰😍😍😍😍😉😉😌😌😌😌😘😘😉🙂☺️☺️🙂😌😌🙂🙂😇😇😉🥰🙃😊🙃🥰😉🙂😉😛😙😛😛😜🧐🤪🤨🥳🥳🥳🥳🥳🥳🤩🤩🤩🤩🤩🥳🤩🤩🥳🥳🤩🤩🥳🙀🙀🙀🙀🙀🙀😻😻😻😻😺😺😺😺😺😺😺😺😺😸😸😸😸😸😸😸😺😻🙀😺😺😽🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐈🐾🐾🐾🐾🐾🐾🐾🐾🐾🐾🐾🐾🐾☀️☀️☀️☀️☀️☀️☀️☀️☀️☀️☀️☀️☀️☀️☀️☀️☀️🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈best podcast e v e r !!!!!!!!!!!!!!!!!!!☑️☑️☑️☑️☑️☑️☑️☑️☑️☑️☑️☑️☑️☑️☑️☑️☑️☑️☑️🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒🆒✅✅✅✅✅✅✅✅✅✅✅✅✅✅✅✅✅✅✅✅✅✅✅✅✅✅❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❕❇️❇️❇️❇️❇️❇️❇️❇️❇️❇️❇️❇️❇️❇️❇️❇️❇️❇️❇️❇️❇️❇️✅💟💟💟💟💟💟💟💟💟💟💟💟❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️🧡🧡🧡🧡🧡🧡🧡🧡🧡💛💛💛💛💛💛💛💛💛💛💛💛💛💚💚💚💚💚💚💚💚💚💚💚💚💚💚💚💙💙💙💙💙💙💙💙💙💙💙💙💙💙💙💜💜💜💜💜💜💜💜💜💜💜💜💜💜💜💜💜🖤🖤🖤🖤🖤🖤🖤🖤🖤🖤🖤💕💕💕💕💕💕💕💕💕💗💗💗💗💗💗💖💖💞💞💓💓💘💘💖💖💖💖💖💖💖💝💝📝📝📝📝📝📝🔮🔮🔮🔮🔮🔮I also consider myself a cat 🐱
  • AliceBahBalice
    I love it
    The new host is awesome and doesn’t sound weird I don’t understand why you don’t like her. I love this pod it’s so fun and informative. It’s so puuurrrrfect! (Cat pun) Thanks a lot! 😻😍❤️
  • newIGmanager
    This podcast is so loud
    Seriously it is deafening compared to every other podcast I listen to, so loud it’s almost caused me to get into a car accident. WHY IS THIS SO LOUD?!
  • Astrokitty23
    I love cats
    A podcast about cats!!! I LOVE IT!!!!
  • what ...?
    I Love CATS!!!!!
    I LOVE CATS!!!!!!!
  • vvghgvvgfcc
    Kitties rule
    I am a cat lover and the D I Y episode is perrrrrfect for my little kitty friend
  • kgck lhckhclhc
    I love this
    I have 3 cats and always like knowing new things about them.
  • chocolate trufflel
    Cats
    Hi, I love cats and I’m so glad I ran into your podcast
  • Unholydemona
    New host too Disney and overwhelming product placement
    Old host might have had interesting views but I felt he was trying to actually educate on cats and issues. New host just too nice and I get it worlds best cat litter is good, but stop trying to shove it down our throats. Might end up dropping if it doesn’t get more educational.
  • Catlovez8
    So good
    You should listen to this pod! It is so good!!!!!!!!!
  • sw33tne$$
    This is great!
    I don’t see how anyone could be mean to this host. Her voice is fine and the show gives me so much information that helps me know how take care of cats!
  • JustAnotherLokiVariant
    Losing my friend & getting a new one
    Well my Kimmie passed two weeks ago from cancer. I chose to have her cremated and then to have the ashes given to me. I don’t know why but I felt like allowing the company to spread her ashes wasn’t satisfying enough. And I didn’t want to bury her in some random place. If I have the ashes in my house will my next cat be able to sense it? Like pick up on the fact that it’s the ashes of another cat? If so where would be the safest place for me to store them? I didn’t realize how much I needed her companionship. I want to get a new cat from the same shelter that I got her from. I have a better idea of what type of cat I prefer but I don’t want to be too hasty with my selection. How do I go about properly selecting the one for me while still trying to deal with the loss?
  • kaoer;jksgklffajhdfcjxioUH
    Cats Cats Cats
    Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats Cats
  • megbundynobody
    No
    Severely false information about cats.
  • Amy awesomesauce
    Good but not for sleep
    I like this podcast because I LOVE cats and it is really informative and good. Michelle’s voice kind of cuts through any sound if you can imagine that so it would not be good for sleeping. It’s good for daytime though!
  • 🌮🥓🌮🥓💥💥💥💥♥️❤️💜🍽
    Plz make a episode about Scottish folds
    Plz make a ep about Scottish folds. They are very interesting cats. They have a lot of cool facts about them. So please please please make a episode about Scottish folds! I highly recommend this pod it is so gooood, also stop about the host’s 🗣 it is fine, also spot the difference 😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😸😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺😺
  • Jennipodcaster
    Learn new things about my favorite thing!
    Who doesn’t love cats? I always make my kitty sit with me while I listen
  • camdenM1561
    Who Needs a Title?
    I haven’t listened to this, and I won’t, so I’m rating 3 stars. Checking that a cat is right for you and your family: •Do you have someone to look after the cat when you are gone for a long time? •Can you afford the cat and the supplies? •Does everybody in your house want a cat? •Are you allergic to cats? •Do you have kindergarteners/pre-school kids that might frighten the cat, grab it, or pull its tail, limbs, or ears? Short hair or long hair? Short-haired cats don’t require your help with grooming. Long-haired cats, on the other hand, require to be brushed daily. Neither needs to be bathed! They lick themselves clean with a sandpaper-textured tongue. (They are scared of water because it’s not something they would’ve encountered much in the wild!) Choosing between a kitten and a cat: Do you want a small, energetic kitten that requires much attention? Or maybe an older, calmer cat that requires less attention than a kitten? It doesn’t have to be that old. A 1y/o cat isn’t a kitten. Remember, a kitten turns into a cat over time. Why wait? (Kitten) Where to get your kitten: If you chose a kitten, try to find a place or person that fosters kittens. Make sure that the kitten is healthy before adopting them into your home!! (Cat) Where to get your cat: The best way to get a cat is a rescue center or adoption center. Consider getting a black (or nearly black) cat. Most rescue and adoption centers have something called “Black Cat Syndrome.” It’s basically where black cats aren’t adopted out as soon as the others, and often they are put down. Supplies (one cat/kitten) •A litter box or two •Food bowls (plastic recommended) •Litter (My family and I use Purina Tidy Cats Clumping Litter) •Pet carrier(s) •Pet brush (for long-haired cats) •Cat food (mixture of dry and wet food twice a day for cats, for kittens, have dry food always available and serve wet food 2 times a day! Make sure the labels say kitten!) •Litter scooper •Cat toys •Small rugs to go in front of the litter box opening •Scratching post(s) •Vet savings if the cat/kitten gets sick or injured •A cat/kitten room (my family and I have our litter boxes, a small cat tree, and food bowls in ours, but having a cat/kitten room is completely optional. I recommend it, though. For a kitten room, try to limit small spaces that they can get stuck in!!)
  • #CatStuff
    Really cool 😎!
    I just started watching this and it’s really cool 😎🥸 I love learning about cats and dogs 🐱🐈. Reading the reviews I’ve seen people are complaining about the hosts voice and to me there’s nothing wrong about and people are also being really mean to the host
  • KMG2011
    Cats are the best!
    I think this show is the beeeeest!🐱🐱🐱🐱🐱🦁🦁🦁🦁🐯🐯🐯🐯🐅🐆🐈🐈 I give it a ⭐️⭐️⭐️⭐️⭐️ out of five star rating! I have a cat myself too!
  • April Moon Doll
    Cattitudes
    I love this podcast as it is informative and entertaining. Michelle’s voice is comforting as it sounds like the women in my childhood neighborhood who looked out for everyone. She shows us how to understand and take care of our cats. At the end of the day, she lets me know that everything is going to be all right.
  • loghhaud
    The hosts voice is so annoying
    I can’t stand to listen to this because of the female hosts voice. She seriously sounds like a character from a Disney channel show I used to watch as a kid; “Mabel”, from “Gravity falls”. Lol I just can’t handle this, I can’t imagine taking anyone seriously if they talked like this lady does.
  • ignghy
    Hey!
    KIDS can listen to this mr cats rule forever! I do and I am 7 I am good at track to my mom said so!😼😼😼😼😼😼😼😼😼😼😼😼😽so? Do you have any more information about your own little rules or do you have the time to be done and do you know how to stop anyway,do you or are you going to start again Are you nice😇➕😇or mean😈vs😇🗡🗡🗡🗡🗡⚔️🏥the best way to know is a dule.quiz: my name has 7 letters and I only have this name,who am I?
  • 💩😻🐱🦄🍌
    Crazy cat lady talking here
    Hi!!! I’ve LOVED cats for my whole LIFE. I've recently got a kitten. Do that completes the number of two cats! One is named Pia she is 19 the other is called panda she is like 10 months old? Somewhere around there. Well that’s it of talking of me! ( for now...) so this podcast really helped with the cats and stuff!!!! I’m too lazy apparently to write why. I’d rather tell you my life for some reason. I am like a crazy cat lady, except I’m only 9.... anyways!!! In my head cats rule!!!!!!!!!! Chao!!!! - Ona H Ha Hav Have Have a Have a n Have a ni Have a nic Have a nice Have a nice d Have a nice da Have a nice day 👍🏼 Have a nice da Have a nice d Have a nice Have a nic Have a ni Have a n Have a Hav Ha H
  • Kaila D. Q.
    Stopped listening to this a while back
    I stopped listening to this podcast a while back because it perpetuates false myths and commonly held beliefs about cats. I’d be very cautious with what you choose to believe from this podcast.
  • alexdobert
    Purr-fect
    I love it and love cats Ps I have some jokes 1. How do you spell cat in 8 letters answer: see ay tee 2. What’s a cats favorite color answer: purr-ple 3.what did the cat say when it saw it’s friend in the park answer: meows it going 🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱🐱
  • AnnaLilyHoffman
    Purrrrr_fect
    So your not a cat purr son but you know that there are some cat lovers like me. Purr sinly I like it. I have loved cats all my life. I am 8 years old. By:Anna H He Hel Hell Hello Hello e Hello ev Hello eve Hello ever Hello every Hello everyo Hello everyon Hello everyone Hello everyon Hello everyo Hello every Hello ever Hello eve Hello ev Hello e Hello Hell Hel He H
  • c̫h̫e̫r̫r̫y̫b̫o̫i̫
    An’ I Oop
    Here! H He Hel Hell Hello Hello e Hello ev Hello eve Hello ever Hello every Hello everyo Hello everyon Hello everyone Hello everyone h Hello everyone ho Hello everyone hop Hello everyone hope Hello everyone hope y Hello everyone hope yo Hello everyone hope you Hello everyone hope you h Hello everyone hope you ha Hello everyone hope you hav Hello everyone hope you have Hello everyone hope you have a Hello everyone hope you have a g Hello everyone hope you have a gr Hello everyone hope you have a gre Hello everyone hope you have a grea Hello everyone hope you have a great Hello everyone hope you have a great d Hello everyone hope you have a great da Hello everyone hope you have a great day Hello everyone hope you have a great da Hello everyone hope you have a great d Hello everyone hope you have a great Hello everyone hope you have a grea Hello everyone hope you have a gre Hello everyone hope you have a gr Hello everyone hope you have a g Hello everyone hope you have a Hello everyone hope you have Hello everyone hope you hav Hello everyone hope you ha Hello everyone hope you h Hello everyone hope you Hello everyone hope yo Hello everyone hope y Hello everyone hope Hello everyone hop Hello everyone ho Hello everyone h Hello everyone Hello everyon Hello everyo Hello every Hello ever Hello eve Hello ev Hello e Hello Hell Hel He H
  • smokeykitty123
    I love it😜❤️
    It helped me a lot because I have 2 cats and And the part that helped me most was the part about not using plastic water and food Bowles and instead using metal or ceramic bowls 🐈
  • taaaaaaaaaacattttttt
    A̶w̶e̶s̶o̶m̶e̶ C̶a̶t̶ P̶o̶d̶c̶a̶s̶t̶!
    I̶ l̶o̶v̶e̶ t̶h̶i̶s̶ s̶o̶ m̶u̶c̶h̶ ❤️
  • Great401235
    So much misinformation
    And advertising Waste Of time
  • amygamez90210
    Best cat podcast
    Every episode I listen to teaches me and is so entertaining, I can’t stop. This genuinely makes me happy to know that there are crazy cat people just like me. My boyfriend doesn’t like it when I talk too much on cats, it’s nice that I can have an outlet. I have always tried to find videos about cats on YouTube, but there are only so many. Until I found out about podcasts, and I was searching for anything to amuse me. Then I had an epiphany! I thought there must be a plethora of cat podcasts.. low and behold I found them. So thank you! My heart goes out to all the cat people❤️🐈
  • igfhffhd
    Cat
    A funny little time
  • Lexi 2014
    Cattitude Rocks!
    Fun podcast series for those who really love cats! The host is funny & very down to earth; she often shares her own stories & she is a great interviewer! This series always includes a nice variety of guests, too. I love to listen while at the gym or while doing chores at home. If u love cats, give it a try!
Disclaimer: The podcast and artwork on this page are property of the podcast owner, and not endorsed by UP.audio.